Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01923

HP ID(1) HP01923
Gene ID(2) 10670
Gene Symbol finder RRAGA
Protein Name Ras-related GTP binding A
RefSeq NM_006570.4
Length of RefSeq (bp) 1657
Chromosome 9p22.1
Reference DDBJ accession
UniGene Hs.432330

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe55C12 pKA1U5 GGCGCTCTCGACTCTCCTGCNTGCCNAGNTGCGCNGTGGANCGGAGCGAGGCGCGGCCTG
ARe58B03 pKA1U5 GGCGCTCTCGACTCTCCTGCCTGCCCAGCTGCGCGGCGGAGCGGAGCGAGGCGCGGCCTG
ARe91C11 pKA1U5 TTTGCCTGCCTGCCCAGCTGCGCGGCGGAGCGGAGCGAGGCGCGGCCTGCGAGTCCCCGG
ARiS045P17 pGCAP10 GCGTATCTCCCGANCCGTTGCCACTGACAGCCGCGGGCGCTCCCATCTGAGTAAGAGCCA
ARiS194D01 pGCAP10 GGACGCAGCGGCTCCCTCCCGGAAAGCGAGCGTATCTCCCGAGCCGTTGCCACTGACAGC
RBb59G11 pGCAP1 GGGGGACGCAGCGGCTCCCTCCCGGAAAGCGAGCGTATCTCCCGAGCCGTTGCCACTGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl