Prev. |  KEGG KO K16185 > 

RIKEN DNA Bank Human Resource - RRAGA

Gene ID NCBI Gene 10670 |  KEGG hsa:10670
Gene Symbol RRAGA
Protein Name Ras related GTP binding A
Synonyms FIP-1|FIP1|RAGA
Ortholog resources KEGG ortholog (KEGG orthology K16185) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087453 IRAL018K13 pOTB7 BC006433 NM_006570 Full
HGY090580 IRAL026H12 pOTB7 BC009990 NM_006570 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005901 W01A014M13 pENTR-TOPO IRAL018K13 BC006433 NM_006570  
HGE005857 W01A014K17 pENTR-TOPO IRAL026H12 BC009990 NM_006570  
HGE005861 W01A014K21 pENTR-TOPO IRAL026H12 BC009990 NM_006570  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062060 ARe55C12 pKA1U5 NM_006570.4  
GGCGCTCTCGACTCTCCTGCNTGCCNAGNTGCGCNGTGGANCGGAGCGAGGCGCGGCCTG
HKR063227 ARe58B03 pKA1U5 NM_006570.4  
GGCGCTCTCGACTCTCCTGCCTGCCCAGCTGCGCGGCGGAGCGGAGCGAGGCGCGGCCTG
HKR076459 ARe91C11 pKA1U5 NM_006570.4  
TTTGCCTGCCTGCCCAGCTGCGCGGCGGAGCGGAGCGAGGCGCGGCCTGCGAGTCCCCGG
HKR218377 ARiS045P17 pGCAP10 NM_006570.4  
GCGTATCTCCCGANCCGTTGCCACTGACAGCCGCGGGCGCTCCCATCTGAGTAAGAGCCA
HKR277673 ARiS194D01 pGCAP10 NM_006570.4  
GGACGCAGCGGCTCCCTCCCGGAAAGCGAGCGTATCTCCCGAGCCGTTGCCACTGACAGC
HKR343755 RBb59G11 pGCAP1 NM_006570.4  
GGGGGACGCAGCGGCTCCCTCCCGGAAAGCGAGCGTATCTCCCGAGCCGTTGCCACTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl