Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01852

HP ID(1) HP01852
Gene ID(2) 7083
Gene Symbol finder TK1
Protein Name thymidine kinase 1, soluble
RefSeq NM_003258.4
Length of RefSeq (bp) 1616
Chromosome 17q23.2-q25.3
Reference DDBJ accession
UniGene Hs.515122

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15B12 pKA1U5 GACTACGGAACCNTGCTTNGGAGANNACTTNGGTTTTCGCTGAAATTCCCGNCAGNNAAC
ARe41C10 pKA1U5 TGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT
ARe75D08 pKA1U5 ATCCTGTGGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAG
ARe79E02 pKA1U5 GACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGC
ARe84F05 pKA1U5 GACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGC
ARe88B11 pKA1U5 GGGGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCA
ARi48C05 pGCAP10 GGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT
ARiS085E17 pGCAP10
RBd15B12 pGCAP10 GACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGC
RBdS110B10 pGCAP10 GGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl