Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TK1

Gene ID (NCBI) 7083
Gene Symbol TK1
Protein Name thymidine kinase 1
Synonyms TK2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00857)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083960 IRAL009O24 pOTB7 BC006484 NM_003258 Full/var
HGY084246 IRAL010K06 pOTB7 BC007986 NM_003258 Full/var
HGY088354 IRAL020O18 pOTB7 BC007872 NM_003258 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004810 W01A012A10 pENTR-TOPO IRAL010K06 BC007986 NM_003258  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046036 ARe15B12 pKA1U5 NM_003258.4  
GACTACGGAACCNTGCTTNGGAGANNACTTNGGTTTTCGCTGAAATTCCCGNCAGNNAAC
HKR056458 ARe41C10 pKA1U5 NM_003258.4  
TGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT
HKR179253 ARi48C05 pGCAP10 NM_003258.4  
GGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT
HKR070080 ARe75D08 pKA1U5 NM_003258.4  
ATCCTGTGGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAG
HKR071698 ARe79E02 pKA1U5 NM_003258.4  
GACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGC
HKR073725 ARe84F05 pKA1U5 NM_003258.4  
GACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGC
HKR075235 ARe88B11 pKA1U5 NM_003258.4  
GGGGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCA
HKR234113 ARiS085E17 pGCAP10 NM_003258.4  
HKR366036 RBd15B12 pGCAP10 NM_003258.4  
GACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGC
HKR444034 RBdS110B10 pGCAP10 NM_003258.4  
GGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.11.06

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_171016.pl