Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110B10

Clone ID RBdS110B10
HP ID HP01852
Gene ID 7083
Gene Symbol TK1
Protein Name thymidine kinase 1, soluble
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003258.4
Length of RefSeq (bp) 1616
Chromosome 17q23.2-q25.3
Reference DDBJ accession
UniGene Hs.515122
5'-terminal sequence GGCTTACTGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAAT
2011.08.28