Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01610

HP ID(1) HP01610
Gene ID(2) 5879
Gene Symbol finder RAC1
Protein Name ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
RefSeq NM_006908.4
Length of RefSeq (bp) 2341
Chromosome 7p22
Reference DDBJ accession
UniGene Hs.413812

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07B03 pKA1U5 GATCGGCTTCCAGNTCCGCGGAGGGCGAGGCGGCGTGGACAGCGGCCCCGGCACCCAGCG
ARe09B03 pKA1U5 GCTCTGCAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCG
ARe14C12 pKA1U5 GCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGAGGGCGAGGC
ARe38F06 pKA1U5 TTTTCCTGGTTTCTCTGCAGTTTTCCTCAGCTTTNGGTGGTGGCCGCTGCCGGGCATCGG
ARe58F06 pKA1U5 TGAGCTTTGGGTGGTGGCCGCTGCCGGGCATCNGCTTCCAGTTCCGCGGAGGGCGAGGCG
ARi10H06 pGCAP10 GGGAGCGGCCATTTCCTGTTTCTCTGCAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCC
ARi34C12 pGCAP10 GGCAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGA
ARi54G02 pGCAP10 GGCGGAGGGCGAGGCGGCGTGGACAGCGGCCCCGGCACCCAGCGCCCCGCCGCCCGCAAG
RBb12E08 pKA1U5 ATCCTGAGCTTTGGGTGGTGGCCGCNTGCCGGGCATCNTGCTTCCAGTTCCGCGGAGGGC
RBd21F07 pGCAP10 GCTCNNCANATATCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCG
RBd57F07 pGCAP10 GAGTGGAGCGGCCATTTCCTGTTTCTCTGCAGTTTTCCTCANCNTTGGGTGGTGGCCGCT
RBd99B10 pGCAP10 GAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGAGG
RBdS014L16 pGCAP10 GGCGGGGGAGGGGAGGCCGGATGTGAGTGGAGCGGCCATTTCCTGTTTCTCTGCAGTTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl