Prev. |  KEGG KO K04392 > 

RIKEN DNA Bank Human Resource - RAC1

Gene ID NCBI Gene 5879 |  KEGG hsa:5879
Gene Symbol RAC1
Protein Name Rac family small GTPase 1
Synonyms MIG5|Rac-1|TC-25|p21-Rac1
Ortholog resources KEGG ortholog (KEGG orthology K04392) in the DNA Bank
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04114 pAxCALNLhRAC1 Shuttle vector to generate rAd harboring human RAC1
RDB03540 pAxCALNLhRAC1 (forward) Shuttle vector to generate rAd harboring human RAC1 (forward)
RDB03478 pAxCALNLhRAC1 (forward) Shuttle vector to generate rAd harboring human RAC1 (forward)
RDB05168 pAxCALNLhRAC1 (forward) Shuttle vector to generate rAd harboring human RAC1 (forward)
RDB05169 pAxCALNLhRAC1 (reverse) Shuttle vector to generate rAd harboring human RAC1 (reverse)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044254 IRAK110K14 pCMV-SPORT6 BC050687 NM_198829 Full
HGY085315 IRAL013E19 pOTB7 BC004247 NM_198829 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042827 ARe07B03 pKA1U5 NM_006908.4  
GATCGGCTTCCAGNTCCGCGGAGGGCGAGGCGGCGTGGACAGCGGCCCCGGCACCCAGCG
HKR043627 ARe09B03 pKA1U5 NM_006908.4  
GCTCTGCAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCG
HKR045660 ARe14C12 pKA1U5 NM_006908.4  
GCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGAGGGCGAGGC
HKR055326 ARe38F06 pKA1U5 NM_006908.4  
TTTTCCTGGTTTCTCTGCAGTTTTCCTCAGCTTTNGGTGGTGGCCGCTGCCGGGCATCGG
HKR063326 ARe58F06 pKA1U5 NM_006908.4  
TGAGCTTTGGGTGGTGGCCGCTGCCGGGCATCNGCTTCCAGTTCCGCGGAGGGCGAGGCG
HKR164174 ARi10H06 pGCAP10 NM_006908.4  
GGGAGCGGCCATTTCCTGTTTCTCTGCAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCC
HKR173660 ARi34C12 pGCAP10 NM_006908.4  
GGCAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGA
HKR181746 ARi54G02 pGCAP10 NM_006908.4  
GGCGGAGGGCGAGGCGGCGTGGACAGCGGCCCCGGCACCCAGCGCCCCGCCGCCCGCAAG
HKR324904 RBb12E08 pKA1U5 NM_006908.4  
ATCCTGAGCTTTGGGTGGTGGCCGCNTGCCGGGCATCNTGCTTCCAGTTCCGCGGAGGGC
HKR368527 RBd21F07 pGCAP10 NM_006908.4  
GCTCNNCANATATCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCG
HKR382927 RBd57F07 pGCAP10 NM_006908.4  
GAGTGGAGCGGCCATTTCCTGTTTCTCTGCAGTTTTCCTCANCNTTGGGTGGTGGCCGCT
HKR399634 RBd99B10 pGCAP10 NM_006908.4  
GAGTTTTCCTCAGCTTTGGGTGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGCGGAGG
HKR405880 RBdS014L16 pGCAP10 NM_006908.4  
GGCGGGGGAGGGGAGGCCGGATGTGAGTGGAGCGGCCATTTCCTGTTTCTCTGCAGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl