Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01526

HP ID(1) HP01526
Gene ID(2) 55974
Gene Symbol finder RAG1AP1
Protein Name recombination activating gene 1 activating protein 1
RefSeq NM_018845.3
Length of RefSeq (bp) 1363
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.292154

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS191A10 pGCAP10 GAGAGCCGCAGGTCTGGGCTGCAGTAGGTCCCGGCAACCGCAGGCTCGCGGCGGGCGCTG
RBd21H12 pGCAP10 GGCAGGCTCGCGGCGGGCGCTGGGCGCGGGATCCGACTCTAGTCGTAATGGAGGCGGGCG
RBd29A05 pGCAP10 GGGAGCATGCGTGGTCTTCACCCTTGGCATGTTCTCCGCCGGCCTCTCGGACCTCAGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl