Prev. |  KEGG KO K15382 > 

RIKEN DNA Bank Human Resource - SLC50A1

Gene ID NCBI Gene 55974 |  KEGG hsa:55974
Gene Symbol SLC50A1
Protein Name solute carrier family 50 member 1
Synonyms HsSWEET1|RAG1AP1|SCP|SWEET1|slv
Ortholog resource in our bank

  SLC50A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005769 IRAK014H01 pCMV-SPORT6 BC009621 NM_018845 Full/var
HGY088609 IRAL021I17 pDNR-LIB BC005943 NM_018845 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276410 ARiS191A10 pGCAP10 NM_018845.3  
GAGAGCCGCAGGTCTGGGCTGCAGTAGGTCCCGGCAACCGCAGGCTCGCGGCGGGCGCTG
HKR368580 RBd21H12 pGCAP10 NM_018845.3  
GGCAGGCTCGCGGCGGGCGCTGGGCGCGGGATCCGACTCTAGTCGTAATGGAGGCGGGCG
HKR371605 RBd29A05 pGCAP10 NM_018845.3  
GGGAGCATGCGTGGTCTTCACCCTTGGCATGTTCTCCGCCGGCCTCTCGGACCTCAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl