Prev. | NRCD Clone D | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01351

HP ID(1) HP01351
Gene ID(2) 1642
Gene Symbol finder DDB1
Protein Name damage-specific DNA binding protein 1, 127kDa
RefSeq NM_001923.3
Length of RefSeq (bp) 4355
Chromosome 11q12-q13
Reference DDBJ accession
UniGene Hs.290758

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe24G08 pKA1U5 GGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGCTCTTTTCGCTTGTGTCCCTCTTTCTA
ARe96A09 pKA1U5 TGCTCTGGGGCGGAGGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTC
ARi20F12 pGCAP10 GGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTCCCTCTTTCTAG
ARi42A08 pGCAP10 GTGTCTCTGGGGCGGAGGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTG
ARiS055K21 pGCAP10 GAGTGGAGTTCGCTGCNCCCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTCCCTCTTTC
ARiS085B23 pGCAP10 GGTCCCTCTTTCTAGTGTCGCGCTCGAGTCCCGACGGGCCGCTCCAAGCCTCGACATGTC
ARiS191C08 pGCAP10 AGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTCCCTCTTTCT
RBd06A05 pGCAP10 GGGATTTCGCTGCNCGCTGTTGGGGGCCACCTGTCTTTTCNATGTGTCCCTCTTTCTAGT
RBd10C05 pGCAP10 GGGGAGTCCTCCAAGAGGCCAGGTGAGGCCGTCCCGTGATGCCCCGCGCCCCGGCCGCTC
RBdS070O08 pGCAP10 GGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl