Prev. |  KEGG KO K10610 > 

RIKEN DNA Bank Human Resource - DDB1

Gene ID NCBI Gene 1642 |  KEGG hsa:1642
Gene Symbol DDB1
Protein Name damage specific DNA binding protein 1
Synonyms DDBA|UV-DDB1|XAP1|XPCE|XPE|XPE-BF
Ortholog resources KEGG ortholog (KEGG orthology K10610) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039452 IRAK098K12 pCMV-SPORT6 BC051764 NM_001923 Full/var
HGX042955 IRAK107G11 pCMV-SPORT6 BC050530 NM_001923 Full/var
HGY091014 IRAL027I22 pOTB7 BC011686 NM_001923 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003581 W01A008P21 pENTR-TOPO IRAK107G11 BC050530 NM_001923  
HGE003240 W01A008B16 pENTR-TOPO IRAL027I22 BC011686 NM_001923  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049752 ARe24G08 pKA1U5 NM_001923.3  
GGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGCTCTTTTCGCTTGTGTCCCTCTTTCTA
HKR078409 ARe96A09 pKA1U5 NM_001923.3  
TGCTCTGGGGCGGAGGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTC
HKR168132 ARi20F12 pGCAP10 NM_001923.3  
GGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTCCCTCTTTCTAG
HKR176808 ARi42A08 pGCAP10 NM_001923.3  
GTGTCTCTGGGGCGGAGGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTG
HKR222261 ARiS055K21 pGCAP10 NM_001923.3  
GAGTGGAGTTCGCTGCNCCCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTCCCTCTTTC
HKR234047 ARiS085B23 pGCAP10 NM_001923.3  
GGTCCCTCTTTCTAGTGTCGCGCTCGAGTCCCGACGGGCCGCTCCAAGCCTCGACATGTC
HKR276456 ARiS191C08 pGCAP10 NM_001923.3  
AGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTCCCTCTTTCT
HKR362405 RBd06A05 pGCAP10 NM_001923.3  
GGGATTTCGCTGCNCGCTGTTGGGGGCCACCTGTCTTTTCNATGTGTCCCTCTTTCTAGT
HKR364053 RBd10C05 pGCAP10 NM_001923.3  
GGGGAGTCCTCCAAGAGGCCAGGTGAGGCCGTCCCGTGATGCCCCGCGCCCCGGCCGCTC
HKR428344 RBdS070O08 pGCAP10 NM_001923.3  
GGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl