Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070O08

Clone ID RBdS070O08
HP ID HP01351
Gene ID 1642
Gene Symbol DDB1
Protein Name damage-specific DNA binding protein 1, 127kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001923.3
Length of RefSeq (bp) 4355
Chromosome 11q12-q13
Reference DDBJ accession
UniGene Hs.290758
5'-terminal sequence GGCAGCGGCAGTGGAGTTCGCTGCGCGCTGTTGGGGGCCACCTGTCTTTTCGCTTGTGTC
2011.08.28