Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01325

HP ID(1) HP01325
Gene ID(2) 22800
Gene Symbol finder RRAS2
Protein Name related RAS viral (r-ras) oncogene homolog 2
RefSeq NM_012250.4
Length of RefSeq (bp) 2345
Chromosome 11p15.2
Reference DDBJ accession
UniGene Hs.502004

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi05B07 pGCAP10 TTGACGGCCATTTGTGGCGGCGCTGGAGGCTGCGTTCGGCAGGCGCTGCGGAGACGCGTA
ARi12B01 pGCAP10 TGGAGGCGCTGCGGAGACGCGTAGAGGAGCGCGCCCCCCGGCCGCTGCCGCCCCTGGCCC
ARiS096P19 pGCAP10 GATTTGTGGCGNCGCTGGANGCTGCNTTCGGCANGCNCTGCGGANACNCGTAGAGGANCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl