Prev. |  KEGG KO K07830 > 

RIKEN DNA Bank Human Resource - RRAS2

Gene ID NCBI Gene 22800 |  KEGG hsa:22800
Gene Symbol RRAS2
Protein Name RAS related 2
Synonyms NS12|TC21
Featured content Mitophagy - human
Ortholog resource in our bank

  RRAS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010770 IRAK026P10 pCMV-SPORT6 BC013106 NM_012250 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162031 ARi05B07 pGCAP10 NM_012250.4  
TTGACGGCCATTTGTGGCGGCGCTGGAGGCTGCGTTCGGCAGGCGCTGCGGAGACGCGTA
HKR164825 ARi12B01 pGCAP10 NM_012250.4  
TGGAGGCGCTGCGGAGACGCGTAGAGGAGCGCGCCCCCCGGCCGCTGCCGCCCCTGGCCC
HKR238779 ARiS096P19 pGCAP10 NM_012250.4  
GATTTGTGGCGNCGCTGGANGCTGCNTTCGGCANGCNCTGCGGANACNCGTAGAGGANCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl