Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01221

HP ID(1) HP01221
Gene ID(2) 7408
Gene Symbol finder VASP
Protein Name vasodilator-stimulated phosphoprotein
RefSeq NM_003370.3
Length of RefSeq (bp) 2298
Chromosome 19q13.2-q13.3
Reference DDBJ accession
UniGene Hs.515469

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118K16 pGCAP10 GGTGGAATTTTGGAACGAAATGTAACGAAGAGAAGTACAGTAGTAAGAGTAACACTGTAG
RBd35G03 pGCAP10 GGTAACGAAGAGAAGTACAGTAGTAAGAGTAACACTGTAGCCGCCACCGGCAAGGGGTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl