Prev. |  KEGG KO K06274 > 

RIKEN DNA Bank Human Resource - VASP

Gene ID NCBI Gene 7408 |  KEGG hsa:7408
Gene Symbol VASP
Protein Name vasodilator stimulated phosphoprotein
Synonyms -
Ortholog resource in our bank

  VASP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025829 IRAK064J13 pCMV-SPORT6 BC038224 NM_003370 Full
HGY089081 IRAL022L17 pOTB7 BC026019 NM_003370 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247456 ARiS118K16 pGCAP10 NM_003370.3  
GGTGGAATTTTGGAACGAAATGTAACGAAGAGAAGTACAGTAGTAAGAGTAACACTGTAG
HKR374147 RBd35G03 pGCAP10 NM_003370.3  
GGTAACGAAGAGAAGTACAGTAGTAAGAGTAACACTGTAGCCGCCACCGGCAAGGGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl