Prev. | NRCD Clone E | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01185

HP ID(1) HP01185
Gene ID(2) 1936
Gene Symbol finder EEF1D
Protein Name eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
RefSeq NM_001960.3
Length of RefSeq (bp) 1256
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.333388

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18F09 pKA1U5 GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
ARe20F11 pKA1U5 GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
ARe34F04 pKA1U5 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARe65G05 pKA1U5 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARe92C03 pKA1U5 GGGGACGGGGGCGCCGGGAGCACTGNTCTCACNGCGCATCCCGGTCGTGGAAGCCCCTCG
ARe95C09 pKA1U5 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARe98H07 pKA1U5 GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
ARf05E04 pKA1U5 GACTGTCTCACGGCGCATCCCGGTCGTGGAAGCCCCTCGGCCAGGCTGCTGGGGCCTAAG
ARi03F04 pGCAP10 GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
ARi04D07 pGCAP10 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARi27A02 pGCAP10 TGCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTG
ARi33D09 pGCAP10 GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
ARi36E06 pGCAP10 GATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGT
ARi52C08 pGCAP10 GACAGGGGGTACGGGGGGTGGGGGCGGGNNTTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
ARi52D09 pGCAP10 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARi63B03 pGCAP10 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARiS013J14 pGCAP10 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
ARiS049L02 pGCAP10 GNGCCGGTCNATATCGNGTGGTACCGCGGCNGCNGATCTCCCTTNNNTGAGGGTTAATTG
ARiS055L18 pGCAP10 CCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
ARiS087M06 pGCAP10 GCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCAC
ARiS150A09 pGCAP10
ARiS150N18 pGCAP10 ACGACTCACTATAGCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGG
ARiS198J23 pGCAP10 GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
RBd08A01 pGCAP10 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
RBd26C05 pGCAP10 GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
RBdS007J19 pGCAP10 GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
RBdS051N18 pGCAP10 GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl