Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051N18

Clone ID RBdS051N18
HP ID HP01185
Gene ID 1936
Gene Symbol EEF1D
Protein Name eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001960.3
Length of RefSeq (bp) 1256
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.333388
5'-terminal sequence GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
2011.08.28