Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EEF1D

Gene ID (NCBI) 1936
Gene Symbol EEF1D
Protein Name eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Synonyms EF-1D|EF1D|FP1047
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K15410)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082190 IRAL005H22 pOTB7 BC000678 NM_001960 Full/var
HGY088166 IRAL020G22 pOTB7 BC007847 NM_032378 Full/var
HGY103355 IRAL058G11 pOTB7 BC071840 NM_001960 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019809 W01A049I17 pENTR-TOPO flj0021i03 AK093756 NM_032378  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082100 ARf05E04 pKA1U5 NM_001960.3  
GACTGTCTCACGGCGCATCCCGGTCGTGGAAGCCCCTCGGCCAGGCTGCTGGGGCCTAAG
HKR161324 ARi03F04 pGCAP10 NM_001960.3  
GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
HKR161679 ARi04D07 pGCAP10 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR047329 ARe18F09 pKA1U5 NM_001960.3  
GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
HKR048131 ARe20F11 pKA1U5 NM_001960.3  
GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
HKR170802 ARi27A02 pGCAP10 NM_001960.3  
TGCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTG
HKR053724 ARe34F04 pKA1U5 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR173281 ARi33D09 pGCAP10 NM_001960.3  
GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
HKR174502 ARi36E06 pGCAP10 NM_001960.3  
GATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGT
HKR180856 ARi52C08 pGCAP10 NM_001960.3  
GACAGGGGGTACGGGGGGTGGGGGCGGGNNTTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
HKR180881 ARi52D09 pGCAP10 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR066149 ARe65G05 pKA1U5 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR185227 ARi63B03 pGCAP10 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR076851 ARe92C03 pKA1U5 NM_001960.3  
GGGGACGGGGGCGCCGGGAGCACTGNTCTCACNGCGCATCCCGGTCGTGGAAGCCCCTCG
HKR078057 ARe95C09 pKA1U5 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR079375 ARe98H07 pKA1U5 NM_001960.3  
GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
HKR205430 ARiS013J14 pGCAP10 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR219866 ARiS049L02 pGCAP10 NM_001960.3  
GNGCCGGTCNATATCGNGTGGTACCGCGGCNGCNGATCTCCCTTNNNTGAGGGTTAATTG
HKR222282 ARiS055L18 pGCAP10 NM_001960.3  
CCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
HKR235094 ARiS087M06 pGCAP10 NM_001960.3  
GCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCAC
HKR260009 ARiS150A09 pGCAP10 NM_001960.3  
HKR260330 ARiS150N18 pGCAP10 NM_001960.3  
ACGACTCACTATAGCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGG
HKR279439 ARiS198J23 pGCAP10 NM_001960.3  
GCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTT
HKR363201 RBd08A01 pGCAP10 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR370453 RBd26C05 pGCAP10 NM_001960.3  
GCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGG
HKR403035 RBdS007J19 pGCAP10 NM_001960.3  
GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC
HKR420730 RBdS051N18 pGCAP10 NM_001960.3  
GCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl