Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01160

HP ID(1) HP01160
Gene ID(2) 5878
Gene Symbol finder RAB5C
Protein Name RAB5C, member RAS oncogene family
RefSeq NM_004583.2
Length of RefSeq (bp) 1674
Chromosome 17q21.2
Reference DDBJ accession
UniGene Hs.712537

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04B10 pKA1U5 GGACACCGCCGGCGGGGAGAGAAGCGGATCCCGNTCCGAGCCCCGGCCCCAAGTAACGCC
ARe22D09 pKA1U5 GAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAAGT
ARi19F09 pGCAP10 GGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAA
ARiS150A02 pGCAP10 GGGAAGTGGAGGCCGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGA
ARiS194D20 pGCAP10 GGAAAGGCGGAAGTGGAGGCCGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCC
RBd01E02 pGCAP10 GGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAAGTAACGC
RBdS022A11 pGCAP10 GGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl