Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAB5C

Gene ID (NCBI) 5878
Gene Symbol RAB5C
Protein Name RAB5C, member RAS oncogene family
Synonyms L1880|RAB5CL|RAB5L|RABL
Databases KEGG hsa:5878 |  NCBI Gene 5878
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07889)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041634 ARe04B10 pKA1U5 NM_004583.2  
GGACACCGCCGGCGGGGAGAGAAGCGGATCCCGNTCCGAGCCCCGGCCCCAAGTAACGCC
HKR048881 ARe22D09 pKA1U5 NM_004583.2  
GAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAAGT
HKR167729 ARi19F09 pGCAP10 NM_004583.2  
GGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAA
HKR260002 ARiS150A02 pGCAP10 NM_004583.2  
GGGAAGTGGAGGCCGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGA
HKR277692 ARiS194D20 pGCAP10 NM_004583.2  
GGAAAGGCGGAAGTGGAGGCCGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCC
HKR360498 RBd01E02 pGCAP10 NM_004583.2  
GGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAAGTAACGC
HKR408811 RBdS022A11 pGCAP10 NM_004583.2  
GGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGCGGATCCCGTCCGAGCCCCGGCCCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.03.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190131.pl