Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01041

HP ID(1) HP01041
Gene ID(2) 5524
Gene Symbol finder PPP2R4
Protein Name protein phosphatase 2A activator, regulatory subunit 4
RefSeq NM_178000.1
Length of RefSeq (bp) 2736
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.400740

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb16A02 pKA1U5 GACCGACATGGCGGCCGTCTTCGCTGTGGTGACTTTAACTCTCGGTTTTCGGTTATAGCC
RBd19F12 pGCAP10 GACCGACATGGCGGCCGTCTTCGCTGTGGTGACTTTAACTCTCGGTTTTCGGTTATAGCC
RBdS154P09 pGCAP10 TTTTTTTCACTTTGGGTCTAGGCTCTTGGGCATGGTGTTCAACAGTAGACCCTAGGAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl