Prev. |  KEGG KO K17605 > 

RIKEN DNA Bank Human Resource - PTPA

Gene ID NCBI Gene 5524 |  KEGG hsa:5524
Gene Symbol PTPA
Protein Name protein phosphatase 2 phosphatase activator
Synonyms PP2A|PPP2R4|PR53
Ortholog resource in our bank

  PTPA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07294 pGL4-phPPP2R4 Promoter collection, Human PPP2R4 promoter
RDB13972 pClneoLuc-PP2A Expression vector of luciferase-fused PP2A.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007657 IRAK019C09 pCMV-SPORT6 BC010497 NM_178003 Partial
HGY081731 IRAL004F11 pOTB7 BC002545 NM_178000 Full
HGY081856 IRAL004K16 pOTB7 BC011605 NM_178000 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100006 M01C050A06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100054 M01C050C06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100102 M01C050E06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100150 M01C050G06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100198 M01C050I06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100246 M01C050K06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100294 M01C050M06 pDONR221 MGC14-F03 BC002545 NM_178000  
HGE100342 M01C050O06 pDONR221 MGC14-F03 BC002545 NM_178000  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326402 RBb16A02 pKA1U5 NM_178000.1  
GACCGACATGGCGGCCGTCTTCGCTGTGGTGACTTTAACTCTCGGTTTTCGGTTATAGCC
HKR367732 RBd19F12 pGCAP10 NM_178000.1  
GACCGACATGGCGGCCGTCTTCGCTGTGGTGACTTTAACTCTCGGTTTTCGGTTATAGCC
HKR461969 RBdS154P09 pGCAP10 NM_178000.1  
TTTTTTTCACTTTGGGTCTAGGCTCTTGGGCATGGTGTTCAACAGTAGACCCTAGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl