Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154P09

Clone ID RBdS154P09
HP ID HP01041
Gene ID 5524
Gene Symbol PPP2R4
Protein Name protein phosphatase 2A activator, regulatory subunit 4
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_178000.1
Length of RefSeq (bp) 2736
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.400740
5'-terminal sequence TTTTTTTCACTTTGGGTCTAGGCTCTTGGGCATGGTGTTCAACAGTAGACCCTAGGAGGA
2011.08.28