Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01032

HP ID(1) HP01032
Gene ID(2) 23212
Gene Symbol finder RRS1
Protein Name ribosome biogenesis regulator homolog (S. cerevisiae)
RefSeq NM_015169.3
Length of RefSeq (bp) 1724
Chromosome 8q13.1
Reference DDBJ accession
UniGene Hs.71827

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007H14 pGCAP10 GATCCCGGCATCTGCACGTGGTTATGCTGCCGGAGTTTGGGCCGCCACTGTAGGAAAAGT
RBdS007J12 pGCAP10 GATCCCGGCATCTGCACGTGGTTATGCTGCCGGAGTTTGGGCCGCCACTGTAGGAAAAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl