Prev. |  KEGG KO K14852 > 

RIKEN DNA Bank Human Resource - RRS1

Gene ID NCBI Gene 23212 |  KEGG hsa:23212
Gene Symbol RRS1
Protein Name ribosome biogenesis regulator 1 homolog
Synonyms -
Ortholog resource in our bank

  RRS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080941 IRAL002F21 pOTB7 BC001811 NM_015169 Full
HGY084582 IRAL011H14 pOTB7 BC013043 NM_015169 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001474 W01A003L10 pENTR-TOPO IRAL002F21 BC001811 NM_015169  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402982 RBdS007H14 pGCAP10 NM_015169.3  
GATCCCGGCATCTGCACGTGGTTATGCTGCCGGAGTTTGGGCCGCCACTGTAGGAAAAGT
HKR403028 RBdS007J12 pGCAP10 NM_015169.3  
GATCCCGGCATCTGCACGTGGTTATGCTGCCGGAGTTTGGGCCGCCACTGTAGGAAAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl