Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00860

HP ID(1) HP00860
Gene ID(2) 9589
Gene Symbol finder WTAP
Protein Name Wilms tumor 1 associated protein
RefSeq NM_004906.3
Length of RefSeq (bp) 2143
Chromosome 6q25-q27
Reference DDBJ accession
UniGene Hs.446091

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi11D06 pGCAP10 GGCGGAGCTCGCGCCAGGCTCCTGGGAAAGGACGGGGAGTGTTACCGGGGAGCAGCTGCT
ARiS085F09 pGCAP10 GGGGACTAGGAGCGCGGCGGGGCCGGCGGCAGAGCTGTCCGGCTGCGCGGTGGCCCGGGG
RBd72F11 pGCAP10 GATGGCAGTCTTACTTCAGGGAGTCTACTCCACTTGCAGGACCTCTTTGATTGAGTTCAC
RBdS081I06 pGCAP10 GGGGACTAGGAGCGCGGCGGGGCCGGCGGCAGAGCTGTCCGGCTGCGCGGTGGCCCGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl