Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081I06

Clone ID RBdS081I06
HP ID HP00860
Gene ID 9589
Gene Symbol WTAP
Protein Name Wilms tumor 1 associated protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004906.3
Length of RefSeq (bp) 2143
Chromosome 6q25-q27
Reference DDBJ accession
UniGene Hs.446091
5'-terminal sequence GGGGACTAGGAGCGCGGCGGGGCCGGCGGCAGAGCTGTCCGGCTGCGCGGTGGCCCGGGG
2011.08.28