Prev. | 

RIKEN DNA Bank Human Resource - WTAP

Gene ID NCBI Gene 9589 |  KEGG hsa:9589
Gene Symbol WTAP
Protein Name WT1 associated protein
Synonyms Mum2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025177 IRAK062P17 pCMV-SPORT6 BC028180 NM_152858
HGY101683 IRAL054D11 pOTB7 BC069192 NM_004906 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014866 W01A037C18 pENTR-TOPO IRAL054D11 BC069192 NM_004906  
HGE014868 W01A037C20 pENTR-TOPO IRAL054D11 BC069192 NM_004906  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164478 ARi11D06 pGCAP10 NM_004906.3  
GGCGGAGCTCGCGCCAGGCTCCTGGGAAAGGACGGGGAGTGTTACCGGGGAGCAGCTGCT
HKR234129 ARiS085F09 pGCAP10 NM_004906.3  
GGGGACTAGGAGCGCGGCGGGGCCGGCGGCAGAGCTGTCCGGCTGCGCGGTGGCCCGGGG
HKR388931 RBd72F11 pGCAP10 NM_004906.3  
GATGGCAGTCTTACTTCAGGGAGTCTACTCCACTTGCAGGACCTCTTTGATTGAGTTCAC
HKR432598 RBdS081I06 pGCAP10 NM_004906.3  
GGGGACTAGGAGCGCGGCGGGGCCGGCGGCAGAGCTGTCCGGCTGCGCGGTGGCCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl