Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00764

HP ID(1) HP00764
Gene ID(2) 53917
Gene Symbol finder RAB24
Protein Name RAB24, member RAS oncogene family
RefSeq NM_130781.2
Length of RefSeq (bp) 1526
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.16258

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd10G12 pGCAP10 GGCGGGAGTCGCGGCGCTGCGGGTAGGAGCCGGGTTGCGGGAGACCCCAGGTTCGGTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl