Prev. |  KEGG KO K07912 > 

RIKEN DNA Bank Human Resource - RAB24

Gene ID NCBI Gene 53917 |  KEGG hsa:53917
Gene Symbol RAB24
Protein Name RAB24, member RAS oncogene family
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K07912) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090716 IRAL026N04 pOTB7 BC010006 NM_001031677 Full
HGY095667 IRAL039C19 pOTB7 BC021263 NM_001031677 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR364156 RBd10G12 pGCAP10 NM_130781.2  
GGCGGGAGTCGCGGCGCTGCGGGTAGGAGCCGGGTTGCGGGAGACCCCAGGTTCGGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl