Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00755

HP ID(1) HP00755
Gene ID(2) 11020
Gene Symbol finder RABL4
Protein Name RAB, member of RAS oncogene family-like 4
RefSeq NM_006860.2
Length of RefSeq (bp) 1021
Chromosome 22q13.1
Reference DDBJ accession
UniGene Hs.415172

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19A09 pKA1U5 GGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGATGTGTGAGCTTGAGAGCCGCG
RBb12F03 pKA1U5 ATCCTGGTGCTTTAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl