Prev. |  KEGG KO K07934 > 

RIKEN DNA Bank Human Resource - IFT27

Gene ID NCBI Gene 11020 |  KEGG hsa:11020
Gene Symbol IFT27
Protein Name intraflagellar transport 27
Synonyms BBS19|RABL4|RAYL
Ortholog resources KEGG ortholog (KEGG orthology K07934) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082209 IRAL005I17 pOTB7 BC000566 NM_006860 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047609 ARe19A09 pKA1U5 NM_006860.2  
GGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGATGTGTGAGCTTGAGAGCCGCG
HKR324923 RBb12F03 pKA1U5 NM_006860.2  
ATCCTGGTGCTTTAGATGCTTCTGGGTCGCGGTGTGCTAAGCGAGGAGTCCGAGTGTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl