Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00708

HP ID(1) HP00708
Gene ID(2) 5928
Gene Symbol finder RBBP4
Protein Name retinoblastoma binding protein 4
RefSeq NM_005610.2
Length of RefSeq (bp) 7943
Chromosome 1p35.1
Reference DDBJ accession
UniGene Hs.16003

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi53C08 pGCAP10 GGCAGCCTCCCCGCCCCTCCCGCAACGCTCGACCCCAGGATTCCCCCGGCTCGCCTGCCC
ARiS118A18 pGCAP10 GAGAGGCCGCGCGCACAGAGCGAGCTCTTGCAGCCTCCCCGCCCCTCCCGCAACNCTCGA
RBd07F11 pGCAP10 GGCTCGACCCCAGGATTCCCCCGGCTCGCCTGCCCGCCATGGCCGACAAGGAAGCAGCCT
RBd17H10 pGCAP10 GCCCGGCTCGCCTGCCCGCCATGGCCGACAAGGAAGCAGCCTTCGACGACGCAGTGGAAG
RBd32C09 pGCAP10 AAAATTGGGGGGCGCAGGAAACAATAGAGGCCGCGCGCACAGAGCGAGCTCTTGCAGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl