Prev. |  KEGG KO K10752 > 

RIKEN DNA Bank Human Resource - RBBP4

Gene ID NCBI Gene 5928 |  KEGG hsa:5928
Gene Symbol RBBP4
Protein Name RB binding protein 4, chromatin remodeling factor
Synonyms NURF55|RBAP48|lin-53
Ortholog resource in our bank

  RBBP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046368 IRAK115P08 pCMV-SPORT6 BC053904 NM_005610 Full
HGY082648 IRAL006K08 pOTB7 BC003092 NM_005610 Full
HGY092465 IRAL031C17 pDNR-LIB BC015123 NM_005610 Partial
HGY103465 IRAL058L01 pOTB7 BC075836 NM_005610 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097206 M01C043A06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097254 M01C043C06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097302 M01C043E06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097350 M01C043G06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097398 M01C043I06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097446 M01C043K06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097494 M01C043M06 pDONR221 MGC11-B03 BC003092 NM_005610  
HGE097542 M01C043O06 pDONR221 MGC11-B03 BC003092 NM_005610  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001961 W01A004P01 pENTR-TOPO IRAL006K08 BC003092 NM_005610  
HGE001963 W01A004P03 pENTR-TOPO IRAL006K08 BC003092 NM_005610  
HGE001965 W01A004P05 pENTR-TOPO IRAL006K08 BC003092 NM_005610  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181256 ARi53C08 pGCAP10 NM_005610.2  
GGCAGCCTCCCCGCCCCTCCCGCAACGCTCGACCCCAGGATTCCCCCGGCTCGCCTGCCC
HKR247218 ARiS118A18 pGCAP10 NM_005610.2  
GAGAGGCCGCGCGCACAGAGCGAGCTCTTGCAGCCTCCCCGCCCCTCCCGCAACNCTCGA
HKR362931 RBd07F11 pGCAP10 NM_005610.2  
GGCTCGACCCCAGGATTCCCCCGGCTCGCCTGCCCGCCATGGCCGACAAGGAAGCAGCCT
HKR366978 RBd17H10 pGCAP10 NM_005610.2  
GCCCGGCTCGCCTGCCCGCCATGGCCGACAAGGAAGCAGCCTTCGACGACGCAGTGGAAG
HKR372857 RBd32C09 pGCAP10 NM_005610.2  
AAAATTGGGGGGCGCAGGAAACAATAGAGGCCGCGCGCACAGAGCGAGCTCTTGCAGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl