Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00599

HP ID(1) HP00599
Gene ID(2) 6234
Gene Symbol finder RPS28
Protein Name ribosomal protein S28
RefSeq NM_001031.4
Length of RefSeq (bp) 401
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.719103

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08G12 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe10G01 pKA1U5 CCGTCTCCTCCAAACCNCCGCCGCNGCCTACCATTCNNTTGTACACCAGCCTTNGNTGCA
ARe10H02 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe13G10 pKA1U5 AAAGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTA
ARe21A09 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe25A07 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe42G08 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe43D01 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe47E05 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe49F02 pKA1U5 GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
ARe49H02 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe56E09 pKA1U5 GCTCTCCGCCAGTACCGTCCGCCGGCGCCGCCATCACGCNNTACCAGNCGTTGTGCAGCC
ARe59H05 pKA1U5 CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
ARe72B08 pKA1U5 GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
ARe72D06 pKA1U5 ATCCTGGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGC
ARe76B05 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCANGGTNCACCAGCCGNTGTGCAGCCTAT
ARe78F05 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe83D07 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe84G09 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARe91H09 pKA1U5 GCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGNTGCAGCCTATCAA
ARe99F01 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARf02C01 pKA1U5 GCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAAG
ARf06C02 pKA1U5 GCTCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
ARf06C03 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi06A06 pGCAP10 CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
ARi12H07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi13H12 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi15H03 pGCAP10 TCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi25A08 pGCAP10 CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
ARi27A07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi35A04 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi41F05 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi47C06 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi47G02 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARi59B02 pGCAP10 GCTCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
ARi71C08 pGCAP10 CGGCCGGCCGATGTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGT
ARiS045K01 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARiS049E12 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARiS085H10 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARiS087A24 pGCAP10
ARiS096F06 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARiS109C03 pGCAP10 CTCTCCNCCNNACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
ARiS118O10 pGCAP10 CGGCCGGCCGATGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTG
ARiS161J09 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARiS194I14 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
ARiS198E18 pGCAP10
RBb09H01 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGTACACCAGCCGTGTGCAGCCTATC
RBb11A10 pKA1U5 GTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
RBb11B04 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBb11H05 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBb12C04 pKA1U5 CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
RBb13G12 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGTACACCAGCCGTGTGCAGCCTATC
RBb16E01 pKA1U5 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCCTGNTACACCAGCCGTGTGCAGCCTATC
RBb25H04 pGCAP1 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBb30G11 pGCAP1 AAATGTGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGC
RBb47E02 pGCAP1 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTTGTGCAGCCTATC
RBb50G12 pGCAP1 CTCTCCGCCAGACCGCCGCCCGCGCCGCCATCATGGTACACCAGCCGTTGTGCAGCCTAT
RBb51G09 pGCAP1 GCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
RBd05H04 pGCAP10 GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
RBd07F05 pGCAP10 GCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
RBd10B01 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd15F07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd17A08 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd27G08 pGCAP10 TGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
RBd40H07 pGCAP10
RBd41F09 pGCAP10
RBd44H07 pGCAP10 CCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd47G12 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd53A12 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd53G09 pGCAP10 GCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAAG
RBd58D07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCNCCNNNNNNCAGCCTATCA
RBd61E05 pGCAP10 GCTCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
RBd61F07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd63H11 pGCAP10 AAGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
RBd64H03 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd77G07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd80C12 pGCAP10 GGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
RBd81G10 pGCAP10 GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
RBd83D05 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBd99G09 pGCAP10 GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
RBdS014F07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS015A09 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS022A14 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS022L20 pGCAP10 AAGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
RBdS051J12 pGCAP10 GCTCTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCC
RBdS070M07 pGCAP10 GNGGCACCCNGNNNCNNCGCCNNCGCCGCCGNCNNNGCCACCANCCGNGTNTNNTCTACN
RBdS075J08 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS083C05 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS110K05 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS156B08 pGCAP10 GCTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTA
RBdS156N07 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
RBdS187C17 pGCAP10 GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl