Prev. |  KEGG KO K02979 > 

RIKEN DNA Bank Human Resource - RPS28

Gene ID NCBI Gene 6234 |  KEGG hsa:6234
Gene Symbol RPS28
Protein Name ribosomal protein S28
Synonyms DBA15|S28|eS28
Ortholog resources KEGG ortholog (KEGG orthology K02979) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080737 IRAL001O01 pOTB7 BC000354 NM_001031 Full
HGY084329 IRAL010N17 pOTB7 BC000354 NM_001031 Full
HGY091148 IRAL027O12 pOTB7 BC021239 NM_001031 Full
HGY102837 IRAL057B13 pDNR-LIB BC070217 NM_001031 Full
HGY103078 IRAL057L14 pDNR-LIB BC070218 NM_001031 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE106011 M01C065A11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106059 M01C065C11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106107 M01C065E11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106155 M01C065G11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106203 M01C065I11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106251 M01C065K11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106299 M01C065M11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE106347 M01C065O11 pDONR221 06_07-A06 BC000354 NM_001031  
HGE124433 M01C111B09 pDONR221 06-2_04-C05 BC000354 NM_001031  
HGE124481 M01C111D09 pDONR221 06-2_04-C05 BC000354 NM_001031  
HGE124529 M01C111F09 pDONR221 06-2_04-C05 BC000354 NM_001031  
HGE098013 M01C045A13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098061 M01C045C13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098109 M01C045E13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098157 M01C045G13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098205 M01C045I13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098253 M01C045K13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098301 M01C045M13 pDONR221 MGC12-A07 BC000354 NM_001031  
HGE098349 M01C045O13 pDONR221 MGC12-A07 BC000354 NM_001031  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043356 ARe08G12 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR044145 ARe10G01 pKA1U5 NM_001031.4  
CCGTCTCCTCCAAACCNCCGCCGCNGCCTACCATTCNNTTGTACACCAGCCTTNGNTGCA
HKR044170 ARe10H02 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR045354 ARe13G10 pKA1U5 NM_001031.4  
AAAGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTA
HKR048409 ARe21A09 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR050007 ARe25A07 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR056952 ARe42G08 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR057273 ARe43D01 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR058901 ARe47E05 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR059722 ARe49F02 pKA1U5 NM_001031.4  
GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR059770 ARe49H02 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR062505 ARe56E09 pKA1U5 NM_001031.4  
GCTCTCCGCCAGTACCGTCCGCCGGCGCCGCCATCACGCNNTACCAGNCGTTGTGCAGCC
HKR063773 ARe59H05 pKA1U5 NM_001031.4  
CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR068832 ARe72B08 pKA1U5 NM_001031.4  
GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR068878 ARe72D06 pKA1U5 NM_001031.4  
ATCCTGGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGC
HKR070429 ARe76B05 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCANGGTNCACCAGCCGNTGTGCAGCCTAT
HKR071325 ARe78F05 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR073279 ARe83D07 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR073753 ARe84G09 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR076577 ARe91H09 pKA1U5 NM_001031.4  
GCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGNTGCAGCCTATCAA
HKR079721 ARe99F01 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR080849 ARf02C01 pKA1U5 NM_001031.4  
GCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAAG
HKR082450 ARf06C02 pKA1U5 NM_001031.4  
GCTCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
HKR082451 ARf06C03 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR162406 ARi06A06 pGCAP10 NM_001031.4  
CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR164975 ARi12H07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR165380 ARi13H12 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR166171 ARi15H03 pGCAP10 NM_001031.4  
TCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR170008 ARi25A08 pGCAP10 NM_001031.4  
CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR170807 ARi27A07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR174004 ARi35A04 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR176525 ARi41F05 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR178854 ARi47C06 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR178946 ARi47G02 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR183626 ARi59B02 pGCAP10 NM_001031.4  
GCTCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
HKR188456 ARi71C08 pGCAP10 NM_001031.4  
CGGCCGGCCGATGTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGT
HKR218241 ARiS045K01 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR219708 ARiS049E12 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR234178 ARiS085H10 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR234824 ARiS087A24 pGCAP10 NM_001031.4  
HKR238526 ARiS096F06 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR243651 ARiS109C03 pGCAP10 NM_001031.4  
CTCTCCNCCNNACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR247546 ARiS118O10 pGCAP10 NM_001031.4  
CGGCCGGCCGATGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTG
HKR264625 ARiS161J09 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR277806 ARiS194I14 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR279314 ARiS198E18 pGCAP10 NM_001031.4  
HKR323769 RBb09H01 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGTACACCAGCCGTGTGCAGCCTATC
HKR324410 RBb11A10 pKA1U5 NM_001031.4  
GTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
HKR324428 RBb11B04 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR324573 RBb11H05 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR324852 RBb12C04 pKA1U5 NM_001031.4  
CTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR325356 RBb13G12 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGTACACCAGCCGTGTGCAGCCTATC
HKR326497 RBb16E01 pKA1U5 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCCTGNTACACCAGCCGTGTGCAGCCTATC
HKR330172 RBb25H04 pGCAP1 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR332155 RBb30G11 pGCAP1 NM_001031.4  
AAATGTGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGC
HKR338898 RBb47E02 pGCAP1 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTTGTGCAGCCTATC
HKR340156 RBb50G12 pGCAP1 NM_001031.4  
CTCTCCGCCAGACCGCCGCCCGCGCCGCCATCATGGTACACCAGCCGTTGTGCAGCCTAT
HKR340553 RBb51G09 pGCAP1 NM_001031.4  
GCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
HKR362172 RBd05H04 pGCAP10 NM_001031.4  
GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR362925 RBd07F05 pGCAP10 NM_001031.4  
GCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
HKR364025 RBd10B01 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR366127 RBd15F07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR366808 RBd17A08 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR370952 RBd27G08 pGCAP10 NM_001031.4  
TGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
HKR376175 RBd40H07 pGCAP10 NM_001031.4  
HKR376529 RBd41F09 pGCAP10 NM_001031.4  
HKR377775 RBd44H07 pGCAP10 NM_001031.4  
CCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR378956 RBd47G12 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR381212 RBd53A12 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR381353 RBd53G09 pGCAP10 NM_001031.4  
GCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAAG
HKR383279 RBd58D07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCNCCNNNNNNCAGCCTATCA
HKR384501 RBd61E05 pGCAP10 NM_001031.4  
GCTCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
HKR384527 RBd61F07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR385379 RBd63H11 pGCAP10 NM_001031.4  
AAGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
HKR385771 RBd64H03 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR390951 RBd77G07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR392060 RBd80C12 pGCAP10 NM_001031.4  
GGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATC
HKR392554 RBd81G10 pGCAP10 NM_001031.4  
GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR393277 RBd83D05 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR399753 RBd99G09 pGCAP10 NM_001031.4  
GTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCAA
HKR405727 RBdS014F07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR406009 RBdS015A09 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR408814 RBdS022A14 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR409084 RBdS022L20 pGCAP10 NM_001031.4  
AAGCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTAT
HKR420628 RBdS051J12 pGCAP10 NM_001031.4  
GCTCTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCC
HKR428295 RBdS070M07 pGCAP10 NM_001031.4  
GNGGCACCCNGNNNCNNCGCCNNCGCCGCCGNCNNNGCCACCANCCGNGTNTNNTCTACN
HKR430224 RBdS075J08 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR433253 RBdS083C05 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR444245 RBdS110K05 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR462432 RBdS156B08 pGCAP10 NM_001031.4  
GCTCCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTA
HKR462719 RBdS156N07 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR474865 RBdS187C17 pGCAP10 NM_001031.4  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl