Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00500

HP ID(1) HP00500
Gene ID(2) 9556
Gene Symbol finder C14orf2
Protein Name chromosome 14 open reading frame 2
RefSeq NM_004894.2
Length of RefSeq (bp) 673
Chromosome 14q32.33
Reference DDBJ accession
UniGene Hs.109052

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26D09 pKA1U5 GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
ARe57E03 pKA1U5 GGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTAT
ARi38F07 pGCAP10 GGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTA
ARiS013A19 pGCAP10 GGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTATTAAAAACATATGGATCCCCA
ARiS055P09 pGCAP10 GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
ARiS087E20 pGCAP10 GCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGAT
ARiS161I04 pGCAP10 GCCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGA
ARiS161N17 pGCAP10 GATCCCCTGCGCGCGCCTGCGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGT
RBb30A12 pGCAP1 GGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTAT
RBb34D01 pGCAP1 GCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTC
RBb46D05 pGCAP1 GGCGGGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCG
RBb46H10 pGCAP1
RBb58D05 pGCAP1 AGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTATTAA
RBd37H07 pGCAP10 GGCGGCCTGGCCGTCGTCTGCGGCGGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAACCG
RBd44F08 pGCAP10 GCCCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCC
RBd99E01 pGCAP10 GTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATG
RBdS014D05 pGCAP10 GGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAA
RBdS051J10 pGCAP10 CGGCCGGCCGATGGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCT
RBdS104G11 pGCAP10 GGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAA
RBdS110H15 pGCAP10 GGCCTGCGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCG
RBdS132B04 pGCAP10 GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
RBdS156P11 pGCAP10 GCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl