Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132B04

Clone ID RBdS132B04
HP ID HP00500
Gene ID 9556
Gene Symbol C14orf2
Protein Name chromosome 14 open reading frame 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004894.2
Length of RefSeq (bp) 673
Chromosome 14q32.33
Reference DDBJ accession
UniGene Hs.109052
5'-terminal sequence GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
2011.08.28