Prev. |  KEGG KO K18193 > 

RIKEN DNA Bank Human Resource - C14orf2

Gene ID NCBI Gene 9556 |  KEGG hsa:9556
Gene Symbol C14orf2
Protein Name chromosome 14 open reading frame 2
Synonyms 6.8PL|MLQ|MP68|PLPM
Ortholog resources KEGG ortholog (KEGG orthology K18193) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080435 IRAL001B11 pOTB7 BC000429 NM_004894 Full
HGY083611 IRAL009A11 pOTB7 BC001944 NM_004894 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050481 ARe26D09 pKA1U5 NM_004894.2  
GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
HKR062899 ARe57E03 pKA1U5 NM_004894.2  
GGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTAT
HKR175327 ARi38F07 pGCAP10 NM_004894.2  
GGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTA
HKR205219 ARiS013A19 pGCAP10 NM_004894.2  
GGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTATTAAAAACATATGGATCCCCA
HKR222369 ARiS055P09 pGCAP10 NM_004894.2  
GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
HKR234916 ARiS087E20 pGCAP10 NM_004894.2  
GCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGAT
HKR264596 ARiS161I04 pGCAP10 NM_004894.2  
GCCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGA
HKR264729 ARiS161N17 pGCAP10 NM_004894.2  
GATCCCCTGCGCGCGCCTGCGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGT
HKR332012 RBb30A12 pGCAP1 NM_004894.2  
GGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTAT
HKR333673 RBb34D01 pGCAP1 NM_004894.2  
GCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTC
HKR338477 RBb46D05 pGCAP1 NM_004894.2  
GGCGGGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCG
HKR338578 RBb46H10 pGCAP1 NM_004894.2  
HKR343277 RBb58D05 pGCAP1 NM_004894.2  
AGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATGCTTCAAAGTATTATTAA
HKR374975 RBd37H07 pGCAP10 NM_004894.2  
GGCGGCCTGGCCGTCGTCTGCGGCGGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAACCG
HKR377728 RBd44F08 pGCAP10 NM_004894.2  
GCCCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCC
HKR399697 RBd99E01 pGCAP10 NM_004894.2  
GTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGATG
HKR405677 RBdS014D05 pGCAP10 NM_004894.2  
GGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAA
HKR420626 RBdS051J10 pGCAP10 NM_004894.2  
CGGCCGGCCGATGGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCT
HKR441755 RBdS104G11 pGCAP10 NM_004894.2  
GGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAA
HKR444183 RBdS110H15 pGCAP10 NM_004894.2  
GGCCTGCGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCG
HKR452828 RBdS132B04 pGCAP10 NM_004894.2  
GGCGCTCGGTGACCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTC
HKR462771 RBdS156P11 pGCAP10 NM_004894.2  
GCTTTCCGAGTTGGCTGCAGATTTGTGGTGCGTTCTGAGCCGTCTGTCCTGCGCCAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl