Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00477

HP ID(1) HP00477
Gene ID(2) 5111
Gene Symbol finder PCNA
Protein Name proliferating cell nuclear antigen
RefSeq NM_182649.1
Length of RefSeq (bp) 1319
Chromosome 20pter-p12
Reference DDBJ accession
UniGene Hs.147433

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53B12 pKA1U5 GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
ARiS045H14 pGCAP10 GGCAGGGTGAGAGCGCGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAG
RBb02F03 pKA1U5 GGCGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTC
RBb13F09 pKA1U5 GGTCGCGACGTTCGCCCGCTCGCTCTGAGGCTCCTGAAGCCGAAACCAGCTAGACTTTCC
RBb21F07 pKA1U5 GGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTT
RBb44D05 pGCAP1 ACCGCGGATGGCCGGAGCTGGCGCCCTGGTTCTGGAGGTAACCGGTTACTGAGGGCGAGA
RBd02A08 pGCAP10 GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
RBd04B01 pGCAP10 GATTATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGT
RBd09A08 pGCAP10 GGACGTCGCAACGCGGCGCAGGGTGAGAGCGCGCGCTTGCGGACGCGGCGGCATTAAACG
RBd18D07 pGCAP10 GGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCC
RBd23C06 pGCAP10 GATTAAANGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT
RBd84F07 pGCAP10 GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
RBd90C04 pGCAP10 GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
RBdS083L17 pGCAP10 TGGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTC
RBdS177P06 pGCAP10 GATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl