Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PCNA

Gene ID (NCBI) 5111
Gene Symbol PCNA
Protein Name proliferating cell nuclear antigen
Synonyms ATLD2
Databases KEGG hsa:5111 |  NCBI Gene 5111
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04802)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04163 pAxCALNLhPCNA Shuttle vector to generate rAd harboring human PCNA
RDB04166 pAxCALNLhPCNA Shuttle vector to generate rAd harboring human PCNA
RDB03597 pAxCALNLhPCNA (forward) Shuttle vector to generate rAd harboring human PCNA (forward)
RDB03600 pAxCALNLhPCNA (forward) Shuttle vector to generate rAd harboring human PCNA (forward)
RDB04721 pAxCALNLhPCNA(forward) Shuttle vector to generate rAd expressing human PCNA
RDB04746 pAxCALNLhPCNA(reverse) Shuttle vector to generate rAd expressing human PCNA
RDB05002 pAxCALNLhPCNA(forward) Shuttle vector to generate rAd expressing human PCNA
RDB05003 pAxCALNLhPCNA(reverse) Shuttle vector to generate rAd expressing human PCNA
RDB05010 pAxCALNLhPCNA(forward) Shuttle vector to generate rAd expressing human PCNA
RDB05011 pAxCALNLhPCNA(reverse) Shuttle vector to generate rAd expressing human PCNA
RDB07365 pGL4-phPCNA Promoter collection, Human PCNA promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080446 IRAL001B22 pOTB7 BC000491 NM_182649 Full
HGY100503 IRAL051E07 pDNR-LIB BC062439 NM_182649 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014203 W01A035I11 pENTR-TOPO IRAL001B22 BC000491 NM_182649  
HGE014205 W01A035I13 pENTR-TOPO IRAL001B22 BC000491 NM_182649  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061236 ARe53B12 pKA1U5 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR218182 ARiS045H14 pGCAP10 NM_182649.1  
GGCAGGGTGAGAGCGCGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAG
HKR320923 RBb02F03 pKA1U5 NM_182649.1  
GGCGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTC
HKR325329 RBb13F09 pKA1U5 NM_182649.1  
GGTCGCGACGTTCGCCCGCTCGCTCTGAGGCTCCTGAAGCCGAAACCAGCTAGACTTTCC
HKR328527 RBb21F07 pKA1U5 NM_182649.1  
GGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTT
HKR337677 RBb44D05 pGCAP1 NM_182649.1  
ACCGCGGATGGCCGGAGCTGGCGCCCTGGTTCTGGAGGTAACCGGTTACTGAGGGCGAGA
HKR360808 RBd02A08 pGCAP10 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR361625 RBd04B01 pGCAP10 NM_182649.1  
GATTATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGT
HKR363608 RBd09A08 pGCAP10 NM_182649.1  
GGACGTCGCAACGCGGCGCAGGGTGAGAGCGCGCGCTTGCGGACGCGGCGGCATTAAACG
HKR367279 RBd18D07 pGCAP10 NM_182649.1  
GGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCC
HKR369254 RBd23C06 pGCAP10 NM_182649.1  
GATTAAANGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT
HKR393727 RBd84F07 pGCAP10 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR396052 RBd90C04 pGCAP10 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR433481 RBdS083L17 pGCAP10 NM_182649.1  
TGGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTC
HKR471166 RBdS177P06 pGCAP10 NM_182649.1  
GATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl