DNA Bank Top |  KEGG KO K04802 > 

RIKEN DNA Bank Human Resource - PCNA

Gene ID NCBI Gene 5111 |  KEGG hsa:5111
Gene Symbol PCNA
Protein Name proliferating cell nuclear antigen
Synonyms ATLD2
Featured content DNA repair (human)

Link

Ortholog resource in our bank

  PCNA


External database

human PCNA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07365 pGL4-phPCNA Promoter collection, Human PCNA promoter    
RDB05011 pAxCALNLhPCNA(reverse) Shuttle vector to generate rAd expressing human PCNA    
RDB05010 pAxCALNLhPCNA(forward) Shuttle vector to generate rAd expressing human PCNA    
RDB05003 pAxCALNLhPCNA(reverse) Shuttle vector to generate rAd expressing human PCNA    
RDB05002 pAxCALNLhPCNA(forward) Shuttle vector to generate rAd expressing human PCNA    
RDB04746 pAxCALNLhPCNA(reverse) Shuttle vector to generate rAd expressing human PCNA    
RDB04721 pAxCALNLhPCNA(forward) Shuttle vector to generate rAd expressing human PCNA    
RDB04166 pAxCALNLhPCNA (reverse) Shuttle vector to generate rAd harboring human PCNA    
RDB04163 pAxCALNLhPCNA (reverse) Shuttle vector to generate rAd harboring human PCNA    
RDB03600 pAxCALNLhPCNA (forward) Shuttle vector to generate rAd harboring human PCNA (forward)    
RDB03597 pAxCALNLhPCNA (forward) Shuttle vector to generate rAd harboring human PCNA (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080446 IRAL001B22 pOTB7 BC000491 NM_182649 Full
HGY100503 IRAL051E07 pDNR-LIB BC062439 NM_182649 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014203 W01A035I11 pENTR-TOPO IRAL001B22 BC000491 NM_182649 done
HGE014205 W01A035I13 pENTR-TOPO IRAL001B22 BC000491 NM_182649  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061236 ARe53B12 pKA1U5 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR218182 ARiS045H14 pGCAP10 NM_182649.1  
GGCAGGGTGAGAGCGCGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAG
HKR320923 RBb02F03 pKA1U5 NM_182649.1  
GGCGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTC
HKR325329 RBb13F09 pKA1U5 NM_182649.1  
GGTCGCGACGTTCGCCCGCTCGCTCTGAGGCTCCTGAAGCCGAAACCAGCTAGACTTTCC
HKR328527 RBb21F07 pKA1U5 NM_182649.1  
GGCGCTTGCGGACGCGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTT
HKR337677 RBb44D05 pGCAP1 NM_182649.1  
ACCGCGGATGGCCGGAGCTGGCGCCCTGGTTCTGGAGGTAACCGGTTACTGAGGGCGAGA
HKR360808 RBd02A08 pGCAP10 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR361625 RBd04B01 pGCAP10 NM_182649.1  
GATTATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGT
HKR363608 RBd09A08 pGCAP10 NM_182649.1  
GGACGTCGCAACGCGGCGCAGGGTGAGAGCGCGCGCTTGCGGACGCGGCGGCATTAAACG
HKR367279 RBd18D07 pGCAP10 NM_182649.1  
GGGCGGCATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCC
HKR369254 RBd23C06 pGCAP10 NM_182649.1  
GATTAAANGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT
HKR393727 RBd84F07 pGCAP10 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR396052 RBd90C04 pGCAP10 NM_182649.1  
GGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTCGCCCGCTCGCTCTGAGGC
HKR433481 RBdS083L17 pGCAP10 NM_182649.1  
TGGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGTCGCGACGTTC
HKR471166 RBdS177P06 pGCAP10 NM_182649.1  
GATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl