Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177P06

Clone ID RBdS177P06
HP ID HP00477
Gene ID 5111
Gene Symbol PCNA
Protein Name proliferating cell nuclear antigen
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_182649.1
Length of RefSeq (bp) 1319
Chromosome 20pter-p12
Reference DDBJ accession
UniGene Hs.147433
5'-terminal sequence GATTAAACGGTTGCAGGCGTAGCAGAGTGGTCGTTGTCTTTCTAGGTCTCAGCCGGTCGT
2011.08.28