Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00459

HP ID(1) HP00459
Gene ID(2) 5660
Gene Symbol finder PSAP
Protein Name prosaposin
RefSeq NM_002778.2
Length of RefSeq (bp) 2839
Chromosome 10q21-q22
Reference DDBJ accession
UniGene Hs.523004

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06C06 pKA1U5 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARe11A05 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARe19G10 pKA1U5 ATCCTGGTGGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTG
ARe30C03 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARe45A01 pKA1U5 GATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGACGGCGCTA
ARe45E08 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARe53D01 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARe53D12 pKA1U5 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARe60A08 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARe67D01 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARe67E11 pKA1U5 TGATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
ARe71F08 pKA1U5 GGCAGACTGCGGAGTCAGACGGCGCTATGTACNCCNTCTTCCTCCTGGCCAGCCTCCTGG
ARe90G10 pKA1U5 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARe98A12 pKA1U5 GAGCGCCTGCGCTCTGGACGGCTTTGGGGCAGGGCAGATTTATATCTGCGGGGGATCAGC
ARe99G11 pKA1U5 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARi11G10 pGCAP10 GATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGACGGCGCTA
ARi17H03 pGCAP10 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARi27G09 pGCAP10 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARi29C04 pGCAP10 CGGCCGGCCGATGAGGGCAGATTTATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCA
ARi33A01 pGCAP10 TGATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
ARi44A07 pGCAP10 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARi50G05 pGCAP10 GATTTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
ARi53B12 pGCAP10 GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARi71H07 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARiS045G16 pGCAP10 GGCATTNCNNANTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
ARiS055O23 pGCAP10 GATTGCNTACTGCNGANTCANACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARiS096A12 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARiS118N01 pGCAP10 GCCGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGC
ARiS150H22 pGCAP10 GCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
ARiS150P12 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
ARiS198G17 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
RBb19E01 pKA1U5 GATTGCAGACTGCGGAGTCAGACGGTGCTATGTNCGCCCTCTTCCTCCTGGCCAGCCTCC
RBb48E11 pGCAP1 AAATGTGGATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGAC
RBd17A01 pGCAP10 AGGGGGCAGGGCAGATTTATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGC
RBd33A03 pGCAP10 CGGCCGGCCGATGCCGCATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTC
RBd51C08 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
RBd55B06 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
RBd78E12 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
RBdS022K03 pGCAP10 GATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGACGGTGCTA
RBdS083A19 pGCAP10 TGGATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
RBdS104D04 pGCAP10 GGCATTGCANACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
RBdS154A17 pGCAP10 GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl