Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154A17

Clone ID RBdS154A17
HP ID HP00459
Gene ID 5660
Gene Symbol PSAP
Protein Name prosaposin
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002778.2
Length of RefSeq (bp) 2839
Chromosome 10q21-q22
Reference DDBJ accession
UniGene Hs.523004
5'-terminal sequence GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
2011.08.28