Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PSAP

Gene ID (NCBI) 5660
Gene Symbol PSAP
Protein Name prosaposin
Synonyms GLBA|SAP1
Databases KEGG hsa:5660 |  NCBI Gene 5660
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12382)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07515 pGL4-phPSAP(SFTPA1) Promoter collection, Human PSAP promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082830 IRAL007B06 pOTB7 BC001503 NM_002778 Full
HGY085517 IRAL013N05 pOTB7 BC004275 NM_002778 Full
HGY089114 IRAL022N02 pOTB7 BC007612 NM_002778 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025381 W01A063H13 pENTR-TOPO IRAL007B06 BC001503 NM_002778  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042454 ARe06C06 pKA1U5 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR044405 ARe11A05 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR047754 ARe19G10 pKA1U5 NM_002778.2  
ATCCTGGTGGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTG
HKR052051 ARe30C03 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR058001 ARe45A01 pKA1U5 NM_002778.2  
GATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGACGGCGCTA
HKR058104 ARe45E08 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR061273 ARe53D01 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR061284 ARe53D12 pKA1U5 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR064008 ARe60A08 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR066873 ARe67D01 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR066907 ARe67E11 pKA1U5 NM_002778.2  
TGATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
HKR068528 ARe71F08 pKA1U5 NM_002778.2  
GGCAGACTGCGGAGTCAGACGGCGCTATGTACNCCNTCTTCCTCCTGGCCAGCCTCCTGG
HKR076154 ARe90G10 pKA1U5 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR079212 ARe98A12 pKA1U5 NM_002778.2  
GAGCGCCTGCGCTCTGGACGGCTTTGGGGCAGGGCAGATTTATATCTGCGGGGGATCAGC
HKR079755 ARe99G11 pKA1U5 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR164554 ARi11G10 pGCAP10 NM_002778.2  
GATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGACGGCGCTA
HKR166971 ARi17H03 pGCAP10 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR170953 ARi27G09 pGCAP10 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR171652 ARi29C04 pGCAP10 NM_002778.2  
CGGCCGGCCGATGAGGGCAGATTTATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCA
HKR173201 ARi33A01 pGCAP10 NM_002778.2  
TGATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
HKR177607 ARi44A07 pGCAP10 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR180149 ARi50G05 pGCAP10 NM_002778.2  
GATTTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
HKR181236 ARi53B12 pGCAP10 NM_002778.2  
GGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR188575 ARi71H07 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR218160 ARiS045G16 pGCAP10 NM_002778.2  
GGCATTNCNNANTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR222359 ARiS055O23 pGCAP10 NM_002778.2  
GATTGCNTACTGCNGANTCANACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR238412 ARiS096A12 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR247513 ARiS118N01 pGCAP10 NM_002778.2  
GCCGCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGC
HKR260190 ARiS150H22 pGCAP10 NM_002778.2  
GCATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTC
HKR260372 ARiS150P12 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR279361 ARiS198G17 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGCGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR327697 RBb19E01 pKA1U5 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGTGCTATGTNCGCCCTCTTCCTCCTGGCCAGCCTCC
HKR339307 RBb48E11 pGCAP1 NM_002778.2  
AAATGTGGATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGAC
HKR366801 RBd17A01 pGCAP10 NM_002778.2  
AGGGGGCAGGGCAGATTTATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGC
HKR373203 RBd33A03 pGCAP10 NM_002778.2  
CGGCCGGCCGATGCCGCATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTC
HKR380456 RBd51C08 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR382030 RBd55B06 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR391308 RBd78E12 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC
HKR409043 RBdS022K03 pGCAP10 NM_002778.2  
GATATCTGCGGGGGATCAGCTGACGCTCCGCATTGCAGACTGCGGAGTCAGACGGTGCTA
HKR433219 RBdS083A19 pGCAP10 NM_002778.2  
TGGATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR441676 RBdS104D04 pGCAP10 NM_002778.2  
GGCATTGCANACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCT
HKR461617 RBdS154A17 pGCAP10 NM_002778.2  
GATTGCAGACTGCGGAGTCAGACGGTGCTATGTACGCCCTCTTCCTCCTGGCCAGCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl