Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00448

HP ID(1) HP00448
Gene ID(2) 11224
Gene Symbol finder RPL35
Protein Name ribosomal protein L35
RefSeq NM_007209.3
Length of RefSeq (bp) 475
Chromosome 9q34.1
Reference DDBJ accession
UniGene Hs.182825

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03B11 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe03H05 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGNTTGATGCAGCAATGGCCAAGATCA
ARe07C03 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe14B01 pKA1U5 GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
ARe20D09 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe31H06 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe34E09 pKA1U5 GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTTCGAGATCTTCGCGGGAAGAAG
ARe36G03 pKA1U5 ACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGCTTGGCGGCTTGTGCAGCAATGGCCAAG
ARe36H06 pKA1U5 ATCCTGGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAA
ARe37D10 pKA1U5 GGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGC
ARe53G03 pKA1U5 GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
ARe58G11 pKA1U5 GGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGNGTTGGCGGCTTGTGCAGCAATGGC
ARe60G01 pKA1U5 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
ARe68C10 pKA1U5 GGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGC
ARe76C01 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCNGTTTGTGCAGCAATGGCCAAGATCAA
ARe82F03 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe83B07 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe84F04 pKA1U5 GGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTC
ARe89E10 pKA1U5 GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTTGGCGGNTTGCTGCAGCAATGGCCAAGAT
ARe90F06 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARe90G12 pKA1U5 GCTCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
ARe91F06 pKA1U5 GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
ARf02A03 pKA1U5 TTGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
ARi05D01 pGCAP10 GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
ARi07F10 pGCAP10 GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
ARi09E12 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARi11E07 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARi13D12 pGCAP10 GAANNTGCNNTTTTCCCNNGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
ARi14B09 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARi16C09 pGCAP10 TGCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCC
ARi18H04 pGCAP10 ATCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
ARi20H10 pGCAP10 GCCCGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAAT
ARi26H10 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
ARi40D09 pGCAP10 GCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGG
ARi43C08 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
ARi53A05 pGCAP10 GCTTTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARi65C10 pGCAP10 CGGCCGGCCGATGCTCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCA
ARi69A02 pGCAP10 GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
ARi69E07 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARi70C03 pGCAP10 GGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGA
ARiS020D12 pGCAP10 GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
ARiS049J18 pGCAP10 GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
ARiS087N15 pGCAP10 GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
ARiS088A20 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARiS096O21 pGCAP10 GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
ARiS118B10 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
ARiS122D24 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARiS122G03 pGCAP10 GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
ARiS161B11 pGCAP10 GGTTGGCGGCTTGTGCANCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
ARiS161N16 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
ARiS191C04 pGCAP10 CGGCCGGCCGATGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAAT
ARiS191I11 pGCAP10 GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
ARiS191J13 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARiS191N11 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
ARiS198H05 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBb08E07 pKA1U5 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBb08F08 pKA1U5 GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
RBb33G03 pGCAP1 GCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAG
RBb34B05 pGCAP1 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBb38E09 pGCAP1 GGGAGCGGGCGGCGGCGTTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGAT
RBb40B06 pGCAP1
RBb42D10 pGCAP1 AATGTGTGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
RBb47C03 pGCAP1 GCCCTCGGAGCGGGCGGCGGCGTTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGC
RBb48E01 pGCAP1 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
RBb54E06 pGCAP1 GCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAG
RBb61C05 pGCAP1 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
RBb66F04 pGCAP1 TTTGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAG
RBb68B04 pGCAP1 GCTCTTTCCCTCGGAAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
RBb68F01 pGCAP1 GAGCCCCGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGC
RBd08B12 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBd14F05 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBd15B07 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBd21H01 pGCAP10 GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
RBd40F01 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBd42D05 pGCAP10 TGCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
RBd45F07 pGCAP10 GCCGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATG
RBd49D07 pGCAP10 GCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
RBd51E05 pGCAP10 GCCTCTTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGA
RBd58F03 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCNCNNNNNANGGCTCGAGATC
RBd59C03 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBd72F05 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
RBd74B04 pGCAP10 GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
RBd95A10 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBd95G10 pGCAP10 GAGCAATGGTGAGAGCTGCGGAATCGGGCGCCATCCGAGCGCTGCCAAGATCAAGGCTCG
RBdS015B06 pGCAP10 GGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGC
RBdS015B11 pGCAP10 GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
RBdS015L23 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBdS040B10 pGCAP10 TTGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
RBdS040L08 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBdS051C17 pGCAP10 GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
RBdS070O17 pGCAP10 GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
RBdS075H08 pGCAP10 GCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
RBdS075N23 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBdS083D22 pGCAP10 GCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAG
RBdS104B04 pGCAP10 GGGAGCGGGCGGCGGCTTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
RBdS105E20 pGCAP10 GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
RBdS105O04 pGCAP10 GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
RBdS110N13 pGCAP10 GCTCTCTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCC
RBdS132D06 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBdS154C20 pGCAP10 GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
RBdS156A21 pGCAP10 GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
RBdS156E06 pGCAP10 GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
RBdS177G11 pGCAP10 GCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
RBdS177M18 pGCAP10 GGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCT
RBdS177D16 pGCAP10 GGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGAGCTG
RBdS187A12 pGCAP10 GACTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl