Prev. |  KEGG KO K02918 > 

RIKEN DNA Bank Human Resource - RPL35

Gene ID NCBI Gene 11224 |  KEGG hsa:11224
Gene Symbol RPL35
Protein Name ribosomal protein L35
Synonyms DBA19|L35
Ortholog resources KEGG ortholog (KEGG orthology K02918) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080661 IRAL001K21 pOTB7 BC000348 NM_007209 Full
HGY087805 IRAL019I13 pDNR-LIB BC010919 NM_007209 Full/var
HGY103311 IRAL058E15 pOTB7 BC071915 NM_007209 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041235 ARe03B11 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR041373 ARe03H05 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGNTTGATGCAGCAATGGCCAAGATCA
HKR042851 ARe07C03 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR045625 ARe14B01 pKA1U5 NM_007209.3  
GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
HKR048081 ARe20D09 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR052574 ARe31H06 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR053705 ARe34E09 pKA1U5 NM_007209.3  
GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTTCGAGATCTTCGCGGGAAGAAG
HKR054547 ARe36G03 pKA1U5 NM_007209.3  
ACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGCTTGGCGGCTTGTGCAGCAATGGCCAAG
HKR054574 ARe36H06 pKA1U5 NM_007209.3  
ATCCTGGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAA
HKR054882 ARe37D10 pKA1U5 NM_007209.3  
GGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGC
HKR061347 ARe53G03 pKA1U5 NM_007209.3  
GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
HKR063355 ARe58G11 pKA1U5 NM_007209.3  
GGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGNGTTGGCGGCTTGTGCAGCAATGGC
HKR064145 ARe60G01 pKA1U5 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR067258 ARe68C10 pKA1U5 NM_007209.3  
GGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGC
HKR070449 ARe76C01 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCNGTTTGTGCAGCAATGGCCAAGATCAA
HKR072923 ARe82F03 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR073231 ARe83B07 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR073724 ARe84F04 pKA1U5 NM_007209.3  
GGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTC
HKR075706 ARe89E10 pKA1U5 NM_007209.3  
GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTTGGCGGNTTGCTGCAGCAATGGCCAAGAT
HKR076126 ARe90F06 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR076156 ARe90G12 pKA1U5 NM_007209.3  
GCTCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
HKR076526 ARe91F06 pKA1U5 NM_007209.3  
GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
HKR080803 ARf02A03 pKA1U5 NM_007209.3  
TTGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
HKR162073 ARi05D01 pGCAP10 NM_007209.3  
GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
HKR162930 ARi07F10 pGCAP10 NM_007209.3  
GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
HKR163708 ARi09E12 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR164503 ARi11E07 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR165284 ARi13D12 pGCAP10 NM_007209.3  
GAANNTGCNNTTTTCCCNNGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
HKR165633 ARi14B09 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR166457 ARi16C09 pGCAP10 NM_007209.3  
TGCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCC
HKR167372 ARi18H04 pGCAP10 NM_007209.3  
ATCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
HKR168178 ARi20H10 pGCAP10 NM_007209.3  
GCCCGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAAT
HKR170578 ARi26H10 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR176081 ARi40D09 pGCAP10 NM_007209.3  
GCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGG
HKR177256 ARi43C08 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR181205 ARi53A05 pGCAP10 NM_007209.3  
GCTTTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR186058 ARi65C10 pGCAP10 NM_007209.3  
CGGCCGGCCGATGCTCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCA
HKR187602 ARi69A02 pGCAP10 NM_007209.3  
GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
HKR187703 ARi69E07 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR188051 ARi70C03 pGCAP10 NM_007209.3  
GGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGA
HKR208084 ARiS020D12 pGCAP10 NM_007209.3  
GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
HKR219834 ARiS049J18 pGCAP10 NM_007209.3  
GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
HKR235127 ARiS087N15 pGCAP10 NM_007209.3  
GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
HKR235220 ARiS088A20 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR238757 ARiS096O21 pGCAP10 NM_007209.3  
GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
HKR247234 ARiS118B10 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR248896 ARiS122D24 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR248947 ARiS122G03 pGCAP10 NM_007209.3  
GCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
HKR264435 ARiS161B11 pGCAP10 NM_007209.3  
GGTTGGCGGCTTGTGCANCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
HKR264728 ARiS161N16 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR276452 ARiS191C04 pGCAP10 NM_007209.3  
CGGCCGGCCGATGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAAT
HKR276603 ARiS191I11 pGCAP10 NM_007209.3  
GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
HKR276629 ARiS191J13 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR276723 ARiS191N11 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR279373 ARiS198H05 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR323303 RBb08E07 pKA1U5 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR323328 RBb08F08 pKA1U5 NM_007209.3  
GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
HKR333347 RBb33G03 pGCAP1 NM_007209.3  
GCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAG
HKR333629 RBb34B05 pGCAP1 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR335305 RBb38E09 pGCAP1 NM_007209.3  
GGGAGCGGGCGGCGGCGTTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGAT
HKR336030 RBb40B06 pGCAP1 NM_007209.3  
HKR336882 RBb42D10 pGCAP1 NM_007209.3  
AATGTGTGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
HKR338851 RBb47C03 pGCAP1 NM_007209.3  
GCCCTCGGAGCGGGCGGCGGCGTTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGC
HKR339297 RBb48E01 pGCAP1 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR341702 RBb54E06 pGCAP1 NM_007209.3  
GCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAG
HKR344453 RBb61C05 pGCAP1 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR346524 RBb66F04 pGCAP1 NM_007209.3  
TTTGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAG
HKR347228 RBb68B04 pGCAP1 NM_007209.3  
GCTCTTTCCCTCGGAAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCA
HKR347321 RBb68F01 pGCAP1 NM_007209.3  
GAGCCCCGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGC
HKR363236 RBd08B12 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR365725 RBd14F05 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR366031 RBd15B07 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR368569 RBd21H01 pGCAP10 NM_007209.3  
GCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCG
HKR376121 RBd40F01 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR376877 RBd42D05 pGCAP10 NM_007209.3  
TGCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
HKR378127 RBd45F07 pGCAP10 NM_007209.3  
GCCGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATG
HKR379679 RBd49D07 pGCAP10 NM_007209.3  
GCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
HKR380501 RBd51E05 pGCAP10 NM_007209.3  
GCCTCTTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGA
HKR383323 RBd58F03 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCNCNNNNNANGGCTCGAGATC
HKR383651 RBd59C03 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR388925 RBd72F05 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR389628 RBd74B04 pGCAP10 NM_007209.3  
GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
HKR398010 RBd95A10 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR398154 RBd95G10 pGCAP10 NM_007209.3  
GAGCAATGGTGAGAGCTGCGGAATCGGGCGCCATCCGAGCGCTGCCAAGATCAAGGCTCG
HKR406030 RBdS015B06 pGCAP10 NM_007209.3  
GGCCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGC
HKR406035 RBdS015B11 pGCAP10 NM_007209.3  
GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
HKR406287 RBdS015L23 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR416034 RBdS040B10 pGCAP10 NM_007209.3  
TTGCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATC
HKR416272 RBdS040L08 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR420465 RBdS051C17 pGCAP10 NM_007209.3  
GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
HKR428353 RBdS070O17 pGCAP10 NM_007209.3  
GGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGA
HKR430176 RBdS075H08 pGCAP10 NM_007209.3  
GCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
HKR430335 RBdS075N23 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR433294 RBdS083D22 pGCAP10 NM_007209.3  
GCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAG
HKR441628 RBdS104B04 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCTTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR442116 RBdS105E20 pGCAP10 NM_007209.3  
GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
HKR442340 RBdS105O04 pGCAP10 NM_007209.3  
GGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATC
HKR444325 RBdS110N13 pGCAP10 NM_007209.3  
GCTCTCTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCC
HKR452878 RBdS132D06 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR461668 RBdS154C20 pGCAP10 NM_007209.3  
GCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAA
HKR462421 RBdS156A21 pGCAP10 NM_007209.3  
GGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGA
HKR462502 RBdS156E06 pGCAP10 NM_007209.3  
GACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAG
HKR470888 RBdS177D16 pGCAP10 NM_007209.3  
GGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGAGCTG
HKR470955 RBdS177G11 pGCAP10 NM_007209.3  
GCTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCA
HKR471106 RBdS177M18 pGCAP10 NM_007209.3  
GGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCT
HKR474812 RBdS187A12 pGCAP10 NM_007209.3  
GACTACTTCCTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl