Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00433

HP ID(1) HP00433
Gene ID(2) 682
Gene Symbol finder BSG
Protein Name basigin (OK blood group)
RefSeq NM_001728.2
Length of RefSeq (bp) 2024
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.501293

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13F03 pKA1U5 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARe18F10 pKA1U5 GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
ARe23E11 pKA1U5 GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGNAATNATGGCGGCTGCGCTGTTCGTGCT
ARe36G06 pKA1U5 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARe77D04 pKA1U5 GATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGCNATNTTGTAGGACCGGCGAGGAATAG
ARe87F03 pKA1U5 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARe99C09 pKA1U5 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARf05D07 pKA1U5 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARi07H11 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARi47B12 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARi48H01 pGCAP10 GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
ARi69H01 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARiS008D20 pGCAP10 GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
ARiS150B07 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARiS150M05 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARiS198N14 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
ARiS198P05 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBb05B04 pKA1U5 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBb05E12 pKA1U5 GGCTTTTTATAGCGGCCGCGGGCGGCGGCGGCCCNTTTTGGAGGTTGTAGGACCGGCGAG
RBb46C05 pGCAP1 TGGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGTCTTGCTGCGCTGTTCGT
RBb50D05 pGCAP1 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBd16G08 pGCAP10 GATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGG
RBd34B02 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBd45H03 pGCAP10 GGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTG
RBd59F05 pGCAP10 GATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGG
RBd61C08 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBd94D07 pGCAP10 GGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTG
RBd94H03 pGCAP10 CGGCCGGCCGATGATAGCGGCCGCGGGCGGCGGCGGCAGCGGTTGGAGGTTGTAGGACCG
RBdS013O05 pGCAP10 GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
RBdS015A05 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBdS083G22 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBdS083I11 pGCAP10 GGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGTGCT
RBdS105C05 pGCAP10 TTGGGGTGGCGTGCGCGCGCCCGGTCCGCGCCTCCGCCGCTTTTTATAGCGGCCGCGGGC
RBdS105L20 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBdS110J06 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
RBdS187I01 pGCAP10 GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl