Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083G22

Clone ID RBdS083G22
HP ID HP00433
Gene ID 682
Gene Symbol BSG
Protein Name basigin (OK blood group)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001728.2
Length of RefSeq (bp) 2024
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.501293
5'-terminal sequence GAGCGGTTGGAGGTTGTAGGACCGGCGAGGAATAGGAATCATGGCGGCTGCGCTGTTCGT
2011.08.28